shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(WDR25-shRNA-Seq2)(CAT#: AdV-SI0364WQ)
This product is a WDR25-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The WD domains of WDR25 gene are involved in protein-protein interactions in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The expression of WDR25-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | WDR25-shRNA-Seq2 |
| Related Target/Protein | WDR25 |
| Region | 3UTR |
| TargetSeq | CTCAAGGGTAGATGAGAGGAA |
| NCBI RefSeq | NM_024515 |
| Alternative Names | C14orf67 |
| Titer | >1*10^10 GC/mL |