shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gsdmd-shRNA-Seq1)(CAT#: AdV-SI4016WQ)
This product is a Gsdmd-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Gsdmd-shRNA-Seq1 |
Related Target/Protein | Gsdmd |
Region | CDS |
TargetSeq | CTGGTGAACATCGGAAAGATT |
NCBI RefSeq | NM_026960 |
Alternative Names | DF5L; DFNA5L; FKSG10; GSDMDC1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |