shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Gsdmd-shRNA-Seq1)(CAT#: AdV-SI4016WQ)
This product is a Gsdmd-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Gsdmd-shRNA-Seq1 |
| Related Target/Protein | Gsdmd |
| Region | CDS |
| TargetSeq | CTGGTGAACATCGGAAAGATT |
| NCBI RefSeq | NM_026960 |
| Alternative Names | DF5L; DFNA5L; FKSG10; GSDMDC1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |