shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Ints10-shRNA-Seq1)(CAT#: AdV-SI4044WQ)

This product is a Ints10-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. Ints10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit and mediates 3-prime end processing of small nuclear RNAs U1 and U2. The expression of Ints10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Ints10-shRNA-Seq1
Related Target/Protein Ints10
Region CDS
TargetSeq GCCGACTTCAACATCCAGTAT
NCBI RefSeq NM_027590
Alternative Names INT10; C8orf35
Titer >1*10^10 GC/mL
Target Gene
Gene ID 55174
Uniprot ID Q9NVR2

Related Products