shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SF3A2-shRNA-Seq2)(CAT#: AdV-SI0060WQ)
This product is a SF3A2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SF3A2 gene encodes subunit 2 of the splicing factor 3a protein complex, which interacts with subunit 1 through its amino-terminus while the single zinc finger domain of subunit 2 plays a role in its binding to the 15S U2 snRNP. The expression of SF3A2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SF3A2-shRNA-Seq2 |
| Related Target/Protein | SF3A2 |
| Region | CDS |
| TargetSeq | CTACGAGACCATTGCCTTCAA |
| NCBI RefSeq | NM_007165 |
| Alternative Names | PRP11; SAP62; PRPF11; SF3a66 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Mitotic chromosome segregation |