shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(JMJD4-shRNA-Seq2)(CAT#: AdV-SI1117WQ)
This product is a JMJD4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. JMJD proteins are mostly epigenetic regulators that demethylate histones. The expression of JMJD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | JMJD4-shRNA-Seq2 |
Related Target/Protein | JMJD4 |
Region | 3UTR |
TargetSeq | GAATCCCATCTGCTGCTGAAT |
NCBI RefSeq | NM_023007 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |