shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(KIAA0513-shRNA-Seq1)(CAT#: AdV-SI1245WQ)

This product is a KIAA0513-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. KIAA0513, a novel signaling molecule that interacts with modulators of neuroplasticity, apoptosis, and the cytoskeleton. The expression of KIAA0513-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert KIAA0513-shRNA-Seq1
Related Target/Protein KIAA0513
Region CDS
TargetSeq CAAGAAGCTGTGCAATGACTT
NCBI RefSeq NM_014732
Titer >1*10^10 GC/mL
Related Diseases Pancreatic carcinoma
Target Gene
Gene ID 9764
Uniprot ID O60268

Related Products