shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(LOC154872-shRNA-Seq3)(CAT#: AdV-SI1267WQ)
This product is a LOC154872-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of LOC154872-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | LOC154872-shRNA-Seq3 |
Related Target/Protein | LOC154872 |
Region | CDS |
TargetSeq | CAGAAATCTACTCTTTGACAA |
NCBI RefSeq | NM_001024603 |
Alternative Names | C7orf77 |
Titer | >1*10^10 GC/mL |