shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(MAGEB2-shRNA-Seq3)(CAT#: AdV-SI1132WQ)
This product is a MAGEB2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. MAGEB2 gene is a member of the MAGEB gene family. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The expression of MAGEB2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | MAGEB2-shRNA-Seq3 |
Related Target/Protein | MAGEB2 |
Region | CDS |
TargetSeq | CAAGATGAAAGTCCTGGAGTT |
NCBI RefSeq | NM_002364 |
Alternative Names | DAM6; CT3.2; MAGE-XP-2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Testis cancer |