shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(OR5H1-shRNA-Seq5)(CAT#: AdV-SI3240WQ)
This product is a OR5H1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR5H1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5H1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | OR5H1-shRNA-Seq5 |
Related Target/Protein | OR5H1 |
Region | CDS |
TargetSeq | CCTTTACTTTATCCAGCCATT |
NCBI RefSeq | NM_001005338 |
Alternative Names | HTPCRX14; HSHTPCRX14 |
Titer | >1*10^10 GC/mL |
Related Diseases | Olfactory dysfunction |