shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LRRN4-shRNA-Seq2)(CAT#: AdV-SI2464WQ)
This product is a LRRN4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The LRRN4 gene may play an important role in hippocampus-dependent long-lasting memory. The expression of LRRN4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | LRRN4-shRNA-Seq2 |
| Related Target/Protein | LRRN4 |
| Region | CDS |
| TargetSeq | GAACTGCAACTTGAGTTCCTT |
| NCBI RefSeq | NM_152611 |
| Alternative Names | NLRR4; NLRR-4; C20orf75; dJ1056H1.1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Nervous system disease |
