shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PLEKHA6-shRNA-Seq2)(CAT#: AdV-SI1390WQ)
This product is a PLEKHA6-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PLEKHA6 gene is associated with psychopathology and response to treatment in schizophrenic patients.The expression of PLEKHA6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PLEKHA6-shRNA-Seq2 |
| Related Target/Protein | PLEKHA6 |
| Region | 3UTR |
| TargetSeq | GCCAATTTGATTTGCTAGTAT |
| NCBI RefSeq | NM_014935 |
| Alternative Names | PEPP3; PEPP-3 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Schizophrenic |
