shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PRM2-shRNA-Seq3)(CAT#: AdV-SI1399WQ)
This product is a PRM2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PRM2 gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. The expression of PRM2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PRM2-shRNA-Seq3 |
| Related Target/Protein | PRM2 |
| Region | CDS |
| TargetSeq | GAAGAGAACATGCAGAAGGCA |
| NCBI RefSeq | NM_002762 |
| Alternative Names | CT94.2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Prostate cancer |