shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(PRM2-shRNA-Seq3)(CAT#: AdV-SI1399WQ)
This product is a PRM2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The PRM2 gene encodes protamine 2, which is cleaved to give rise to a family of protamine 2 peptides. The expression of PRM2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | PRM2-shRNA-Seq3 |
Related Target/Protein | PRM2 |
Region | CDS |
TargetSeq | GAAGAGAACATGCAGAAGGCA |
NCBI RefSeq | NM_002762 |
Alternative Names | CT94.2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Prostate cancer |