shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(VRTN-shRNA-Seq2)(CAT#: AdV-SI1103WQ)
This product is a VRTN-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. VRTN is required for the development of thoracic vertebrae in mammals. VRTN is a novel DNA-binding transcription factor as it localizes exclusively in the nucleus, binds to DNA on a genome-wide scale and regulates the transcription of a set of genes that harbor VRTN binding motifs. The expression of VRTN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | VRTN-shRNA-Seq2 |
Related Target/Protein | VRTN |
Region | CDS |
TargetSeq | CCAAGTTGTACCTGGAGCATT |
NCBI RefSeq | NM_018228 |
Alternative Names | vertnin; C14orf115 |
Titer | >1*10^10 GC/mL |
Related Diseases | Development of Thoracic Vertebrae in Mammals |