shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Zcchc5-shRNA-Seq1)(CAT#: AdV-SI3918WQ)

This product is a Zcchc5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Zcchc5 gene is a member of a family of gag-related retrotransposon genes. These genes appear to have lost the ability to retrotranspose. The expression of Zcchc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Zcchc5-shRNA-Seq1
Related Target/Protein Zcchc5
Region CDS
TargetSeq CCACCAACCTATCTGATGTGA
NCBI RefSeq NM_199468
Alternative Names Mar3; ZHC5; Mart3; SIRH9; ZCCHC5; RTL3
Titer >1*10^10 GC/mL
Target Gene
Gene ID 203430
Uniprot ID Q8N8U3

Related Products