shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Zcchc5-shRNA-Seq1)(CAT#: AdV-SI3918WQ)
This product is a Zcchc5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Zcchc5 gene is a member of a family of gag-related retrotransposon genes. These genes appear to have lost the ability to retrotranspose. The expression of Zcchc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Zcchc5-shRNA-Seq1 |
Related Target/Protein | Zcchc5 |
Region | CDS |
TargetSeq | CCACCAACCTATCTGATGTGA |
NCBI RefSeq | NM_199468 |
Alternative Names | Mar3; ZHC5; Mart3; SIRH9; ZCCHC5; RTL3 |
Titer | >1*10^10 GC/mL |