shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(ZDHHC19-shRNA-Seq1)(CAT#: AdV-SI1080WQ)

This product is a ZDHHC19-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. ZDHHC19 is a Protein Coding gene. Gene Ontology (GO) annotations related to this gene include protein-cysteine S-palmitoyltransferase activity. The expression of ZDHHC19-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert ZDHHC19-shRNA-Seq1
Related Target/Protein ZDHHC19
Region CDS
TargetSeq GCCAGCAACTGGTATTTAACA
NCBI RefSeq NM_144637
Alternative Names DHHC19
Titer >1*10^10 GC/mL
Related Diseases Liver cancer
Target Gene
Gene ID 131540
Uniprot ID Q8WVZ1

Related Products