shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Patl2-shRNA-Seq1)(CAT#: AdV-SI3171WQ)

This product is a Patl2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Patl2 gene encodes a RNA-binding protein that acts as a translational repressor. The expression of Patl2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Patl2-shRNA-Seq1
Related Target/Protein Patl2
Region CDS
TargetSeq CAGGGTTGAGTTTCTCCAGTT
NCBI RefSeq NM_026251
Alternative Names OOMD4; Pat1a; hPat1a
Titer >1*10^10 GC/mL
Target Gene
Gene ID 197135
Uniprot ID C9JE40

Related Products