shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Adm2-shRNA-Seq1)(CAT#: AdV-SI2811WQ)
This product is a Adm2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Adm2 gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis. The expression of Adm2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Adm2-shRNA-Seq1 |
Related Target/Protein | Adm2 |
Region | 3UTR |
TargetSeq | CTATGAGGATATGTGGATCTA |
NCBI RefSeq | NM_182928 |
Alternative Names | AM2; dJ579N16.4 |
Titer | >1*10^10 GC/mL |
Related Diseases | Gastrointestinal and cardiovascular disease |