shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(ARMC4-shRNA-Seq1)(CAT#: AdV-SI0588WQ)

This product is a ARMC4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The ARMC4 gene encoded protein contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. The expression of ARMC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert ARMC4-shRNA-Seq1
Related Target/Protein ARMC4
Region 3UTR
TargetSeq GTTGTTAGCAAACCCTTTCAA
NCBI RefSeq NM_018076
Alternative Names CILD23
Titer >1*10^10 GC/mL
Related Diseases Primary ciliary dyskensia (PCD)
Target Gene
Gene ID 55130
Uniprot ID Q5T2S8

Related Products