shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(C6orf141-shRNA-Seq1)(CAT#: AdV-SI0809WQ)

This product is a C6orf141-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Low C6orf141 Expression is Significantly Associated with a Poor Prognosis in Patients with Oral Cancer. The expression of C6orf141-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert C6orf141-shRNA-Seq1
Related Target/Protein C6orf141
Region CDS
TargetSeq CCCAACTACCCTTCTGTCTTT
NCBI RefSeq NM_153344
Titer >1*10^10 GC/mL
Related Diseases Oral Cancer
Target Gene
Gene ID 135398
Uniprot ID Q5SZD1

Related Products