shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CA3-shRNA-Seq1)(CAT#: AdV-SI0758WQ)
This product is a CA3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The CA3 is a member of a multigene family (at least six separate genes are known) that encodes carbonic anhydrase isozymes. The expression of the CA3 gene is strictly tissue specific and present at high levels in skeletal muscle and much lower levels in cardiac and smooth muscle. The expression of CA3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | CA3-shRNA-Seq1 |
| Related Target/Protein | CA3 |
| Region | CDS |
| TargetSeq | CCCGTTGAGCTGCATACTAAA |
| NCBI RefSeq | NM_005181 |
| Alternative Names | Car3; CAIII |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Duchenne muscle dystrophy |