shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CASC4-shRNA-Seq2)(CAT#: AdV-SI0618WQ)

This product is a CASC4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The increased expression level of CASC4 gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. The expression of CASC4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert CASC4-shRNA-Seq2
Related Target/Protein CASC4
Region CDS
TargetSeq GAATGAAGAACCCTCAAGCAA
NCBI RefSeq NM_138423
Alternative Names H63
Titer >1*10^10 GC/mL
Related Diseases Ovarian cancers, Breast cancer
Target Gene
Gene ID 113201
Uniprot ID Q6P4E1

Related Products