shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(CCDC84-shRNA-Seq1)(CAT#: AdV-SI3190WQ)

This product is a CCDC84-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The CCDC84 gene encodes a protein thought to contain a coiled coil motif. The expression of CCDC84-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert CCDC84-shRNA-Seq1
Related Target/Protein CCDC84
Region CDS
TargetSeq GCACAAGAAAGCAACCAACAA
NCBI RefSeq NM_198489
Alternative Names DLNB14
Titer >1*10^10 GC/mL
Target Gene
Gene ID 338657
Uniprot ID Q86UT8

Related Products