shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Gpatch2-shRNA-Seq3)(CAT#: AdV-SI2677WQ)
This product is a Gpatch2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Gpatch2 gene encodes a nuclear factor that may play a role in spermatogenesis and in tumor growth during breast cancer. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Gpatch2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Gpatch2-shRNA-Seq3 |
Related Target/Protein | Gpatch2 |
Region | CDS |
TargetSeq | GCATCAGCTTCTGAGAGATAA |
NCBI RefSeq | NM_026367 |
Alternative Names | Pfa1; CT110; GPATC2; PPP1R30 |
Titer | >1*10^10 GC/mL |
Related Diseases | Breast cancer |