shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(HOOK2-shRNA-Seq1)(CAT#: AdV-SI2467WQ)
This product is a HOOK2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The HOOK2 gene encodes a member of Hook proteins that are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The expression of HOOK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | HOOK2-shRNA-Seq1 |
Related Target/Protein | HOOK2 |
Region | CDS |
TargetSeq | CCAGAGACGTATGGCAACTTT |
NCBI RefSeq | NM_013312 |
Alternative Names | HK2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Obesity and type 2 diabetes |