shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(HOOK2-shRNA-Seq1)(CAT#: AdV-SI2467WQ)

This product is a HOOK2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The HOOK2 gene encodes a member of Hook proteins that are cytosolic coiled-coil proteins that contain conserved N-terminal domains, which attach to microtubules, and more divergent C-terminal domains, which mediate binding to organelles. The expression of HOOK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert HOOK2-shRNA-Seq1
Related Target/Protein HOOK2
Region CDS
TargetSeq CCAGAGACGTATGGCAACTTT
NCBI RefSeq NM_013312
Alternative Names HK2
Titer >1*10^10 GC/mL
Related Diseases Obesity and type 2 diabetes
Target Gene
Gene ID 29911
Uniprot ID Q96ED9

Related Products