shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Hspa4-shRNA-Seq2)(CAT#: AdV-SI2791WQ)

This product is a Hspa4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Hspa4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Hspa4-shRNA-Seq2
Related Target/Protein Hspa4
Region CDS
TargetSeq GAGTGAAGATGATCGTAATAC
NCBI RefSeq NM_008300
Alternative Names RY; APG-2; HSPH2; hsp70; hsp70RY; HEL-S-5a; HS24/P52
Titer >1*10^10 GC/mL
Target Gene
Gene ID 3308
Uniprot ID P34932

Related Products