shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Hsph1-shRNA-Seq6)(CAT#: AdV-SI2820WQ)
This product is a Hsph1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Hsph1 gene encodes a member of the heat shock protein 70 family of proteins and functions as a nucleotide exchange factor for the molecular chaperone heat shock cognate 71 kDa protein (Hsc70). The expression of Hsph1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Hsph1-shRNA-Seq6 |
| Related Target/Protein | Hsph1 |
| Region | 3UTR |
| TargetSeq | GCTAGTGAACTGTAGCAGCAT |
| NCBI RefSeq | NM_013559 |
| Alternative Names | HSP105; HSP105A; HSP105B; NY-CO-25 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |