shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(JOSD2-shRNA-Seq1)(CAT#: AdV-SI0872WQ)

This product is a JOSD2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert JOSD2-shRNA-Seq1
Related Target/Protein JOSD2
Region CDS
TargetSeq CACCGGCAACTATGATGTCAA
NCBI RefSeq NM_138334
Alternative Names SBBI54
Titer >1*10^10 GC/mL
Target Gene
Gene ID 126119
Uniprot ID Q8TAC2

Related Products