shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(LAMP3-shRNA-Seq1)(CAT#: AdV-SI0740WQ)
This product is a LAMP3-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. LAMP3 regulates hepatic lipid metabolism through activating PI3K/Akt pathway. LAMP3 promotes the invasion of osteosarcoma cells via SPP1 signaling. LAMP3 expression correlated with poor clinical outcome in human ovarian cancer. The expression of LAMP3-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LAMP3-shRNA-Seq1 |
| Related Target/Protein | LAMP3 |
| Region | CDS |
| TargetSeq | GTCAGTCAAGACTGGAATTTA |
| NCBI RefSeq | NM_014398 |
| Alternative Names | LAMP; CD208; DCLAMP; LAMP-3; TSC403; DC LAMP; DC-LAMP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Oral squamous cell carcinoma |