shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SESTD1-shRNA-Seq2)(CAT#: AdV-SI0785WQ)
This product is a SESTD1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SESTD1 gene may act as the primary docking protein directing membrane turnover and assembly of the transient receptor potential channels TRPC4 and TRPC5. The expression of SESTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SESTD1-shRNA-Seq2 |
Related Target/Protein | SESTD1 |
Region | CDS |
TargetSeq | GCTGAGTGTCACCTTAGACTT |
NCBI RefSeq | NM_178123 |
Alternative Names | SOLO |
Titer | >1*10^10 GC/mL |
Related Diseases | Lithium-responsive bipolar disorder |