shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(N4bp2-shRNA-Seq5)(CAT#: AdV-SI2777WQ)
This product is a N4bp2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by N4bp2 gene binds and hydrolyzes ATP, may function as a 5'-polynucleotide kinase, and has the capacity to be a ubiquitylation substrate. The expression of N4bp2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | N4bp2-shRNA-Seq5 |
| Related Target/Protein | N4bp2 |
| Region | CDS |
| TargetSeq | CCCACAAAGTATTAGATGCTA |
| NCBI RefSeq | NM_001024917 |
| Alternative Names | B3BP |
| Titer | >1*10^10 GC/mL |
| Related Diseases | B-cell leukemia/lymphoma |