shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Nudcd1-shRNA-Seq2)(CAT#: AdV-SI2700WQ)

This product is a Nudcd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Nudcd1-shRNA-Seq2
Related Target/Protein Nudcd1
Region CDS
TargetSeq CCTAATGGAAATGGTCTAATG
NCBI RefSeq NM_026149
Alternative Names CML66; OVA66
Titer >1*10^10 GC/mL
Related Diseases Solid tumors
Target Gene
Gene ID 84955
Uniprot ID Q96RS6

Related Products