shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(OR4L1-shRNA-Seq2)(CAT#: AdV-SI2509WQ)

This product is a OR4L1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR4L1 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR4L1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert OR4L1-shRNA-Seq2
Related Target/Protein OR4L1
Region CDS
TargetSeq GCTTGTTTCTTACATTGTCAT
NCBI RefSeq XM_063310
Alternative Names OR4L2P; OR14-28
Titer >1*10^10 GC/mL
Related Diseases Olfactory dysfunction
Target Gene
Gene ID 122742
Uniprot ID Q8NH43

Related Products