shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SFTA2-shRNA-Seq1)(CAT#: AdV-SI0077WQ)
This product is a SFTA2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by SFTA2 is a novel secretory peptide highly expressed in the lung. The expression of SFTA2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | SFTA2-shRNA-Seq1 |
Related Target/Protein | SFTA2 |
Region | CDS |
TargetSeq | CGGGTATGACTTTGCAACTGA |
NCBI RefSeq | NM_205854 |
Alternative Names | SP-G; SFTPG; UNQ541; GSGL541 |
Titer | >1*10^10 GC/mL |
Related Diseases | Lung cancer |