shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PRR14-shRNA-Seq2)(CAT#: AdV-SI0934WQ)
This product is a PRR14-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by PRR14 gene tethers heterochromatin to the nuclear laminar scaffold by binding heterochromatin protein 1 (HP1) and the nuclear lamina. The expression of PRR14-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | PRR14-shRNA-Seq2 |
| Related Target/Protein | PRR14 |
| Region | CDS |
| TargetSeq | CTCCTGGAGGAAGAAACAGTA |
| NCBI RefSeq | NM_024031 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Lung cancer |
