shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Pomp-shRNA-Seq2)(CAT#: AdV-SI2576WQ)

This product is a Pomp-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Pomp gene is a molecular chaperone that binds 20S preproteasome components and is essential for 20S proteasome formation. The expression of Pomp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Pomp-shRNA-Seq2
Related Target/Protein Pomp
Region CDS
TargetSeq GCTCAAACCTCTCACTGGATA
NCBI RefSeq NM_025624
Alternative Names UMP1; PRAAS2; HSPC014; C13orf12; PNAS-110
Titer >1*10^10 GC/mL
Related Diseases KLICK syndrome
Target Gene
Gene ID 51371
Uniprot ID Q9Y244

Related Products