shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(PRELID2-shRNA-Seq2)(CAT#: AdV-SI0798WQ)

This product is a PRELID2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The expression of PRELID2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert PRELID2-shRNA-Seq2
Related Target/Protein PRELID2
Region CDS
TargetSeq GCTCAATCCTCGGGAAAGAAA
NCBI RefSeq NM_138492
Titer >1*10^10 GC/mL
Related Diseases Chronic Hepatitis B infection
Target Gene
Gene ID 153768
Uniprot ID Q8N945

Related Products