shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Scg2-shRNA-Seq1)(CAT#: AdV-SI3122WQ)
This product is a Scg2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Scg2 gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins and is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The expression of Scg2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Scg2-shRNA-Seq1 |
| Related Target/Protein | Scg2 |
| Region | CDS |
| TargetSeq | CCCTTGATTCTCAGTCTATTT |
| NCBI RefSeq | NM_009129 |
| Alternative Names | SN; CHGC; EM66; SgII |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Nervous system disease |