shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SDHAF2-shRNA-Seq2)(CAT#: AdV-SI0979WQ)
This product is a SDHAF2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SDHAF2 gene encodes a mitochondrial protein needed for the flavination of a succinate dehydrogenase complex subunit required for activity of the complex. The expression of SDHAF2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SDHAF2-shRNA-Seq2 |
| Related Target/Protein | SDHAF2 |
| Region | CDS |
| TargetSeq | CCTGCTCTATGAGAGCAGAAA |
| NCBI RefSeq | NM_017841 |
| Alternative Names | PGL2; SDH5; C11orf79 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Paraganglioma |