shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Selm-shRNA-Seq1)(CAT#: AdV-SI3152WQ)
This product is a Selm-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Selm gene belongs to the selenoprotein M/SEP15 family and may be involved in neurodegenerative disorders. The expression of Selm-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Selm-shRNA-Seq1 |
| Related Target/Protein | Selm |
| Region | CDS |
| TargetSeq | CTGTGGAGGATGACAGTTGAA |
| NCBI RefSeq | NM_053267 |
| Alternative Names | SELM; SEPM; SELENOM |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurodegenerative disorders |
