shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SPAG17-shRNA-Seq2)(CAT#: AdV-SI0723WQ)
This product is a SPAG17-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPAG17 gene encoded protein is required for the proper function of the axoneme. SPAG17 deficiency results in skeletal malformations and bone abnormalities. The expression of SPAG17-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SPAG17-shRNA-Seq2 |
| Related Target/Protein | SPAG17 |
| Region | CDS |
| TargetSeq | CGATAAGTTACTATGGATCAA |
| NCBI RefSeq | NM_206996 |
| Alternative Names | PF6; CT143 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Skeletal malformations and bone abnormalities |