shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SPAG17-shRNA-Seq3)(CAT#: AdV-SI0724WQ)

This product is a SPAG17-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The SPAG17 gene encoded protein is required for the proper function of the axoneme. SPAG17 deficiency results in skeletal malformations and bone abnormalities. The expression of SPAG17-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert SPAG17-shRNA-Seq3
Related Target/Protein SPAG17
Region CDS
TargetSeq GCACAGTATGAAGAACCGCAA
NCBI RefSeq NM_206996
Alternative Names PF6; CT143
Titer >1*10^10 GC/mL
Related Diseases Skeletal malformations and bone abnormalities
Target Gene
Gene ID 200162
Uniprot ID Q6Q759

Related Products