shRNA Adenovirus Serotype 5 (ΔE1/E3), p7SK-(Tmub1-shRNA-Seq1)(CAT#: AdV-SI3982WQ)
This product is a Tmub1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Tmub1 gene encodes a protein that may contribute to the regulation of translation during cell-cycle progression and cell proliferation. The expression of Tmub1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Tmub1-shRNA-Seq1 |
| Related Target/Protein | Tmub1 |
| Region | 3UTR |
| TargetSeq | CTAGTTTCAAAGAGCTGCCTA |
| NCBI RefSeq | NM_022418 |
| Alternative Names | DULP; SB144; C7orf21 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |
