shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(SPEM1-shRNA-Seq1)(CAT#: AdV-SI3037WQ)

This product is a SPEM1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The SPEM1 gene is required for proper cytoplasm removal during spermatogenesis. The expression of SPEM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert SPEM1-shRNA-Seq1
Related Target/Protein SPEM1
Region 3UTR
TargetSeq GTGAACTCAGAAACTGAGAAA
NCBI RefSeq NM_199339
Alternative Names C17orf83
Titer >1*10^10 GC/mL
Target Gene
Gene ID 374768
Uniprot ID Q8N4L4

Related Products