shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Svs3a-shRNA-Seq1)(CAT#: AdV-SI3101WQ)
This product is a Svs3a-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Svs3a-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | AdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Modification | ΔE1/E3 |
Insert | Svs3a-shRNA-Seq1 |
Related Target/Protein | Svs3a |
Region | CDS |
TargetSeq | GAAGACATAGTTTGTGAAGAA |
NCBI RefSeq | NM_021363 |
Alternative Names | Svp3; Svs3; Semg2; Svp-3; BB121242; 9530026M05Rik |
Titer | >1*10^10 GC/mL |
Related Diseases | Infertility |