shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Tbc1d22b-shRNA-Seq1)(CAT#: AdV-SI3170WQ)
This product is a Tbc1d22b-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Tbc1d22b gene may act as a GTPase-activating protein for Rab family protein. The expression of Tbc1d22b-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Tbc1d22b-shRNA-Seq1 |
| Related Target/Protein | Tbc1d22b |
| Region | 3UTR |
| TargetSeq | CGAGTATGTGTGTGTGTGTAT |
| NCBI RefSeq | NM_198647 |
| Alternative Names | C6orf197 |
| Titer | >1*10^10 GC/mL |
