shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(WDR46-shRNA-Seq2)(CAT#: AdV-SI0995WQ)
This product is a WDR46-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | WDR46-shRNA-Seq2 |
| Related Target/Protein | WDR46 |
| Region | CDS |
| TargetSeq | CTGGAGAGTAATCCATACAGA |
| NCBI RefSeq | NM_005452 |
| Alternative Names | UTP7; BING4; FP221; C6orf11 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Respiratory Disease |