shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(WDR46-shRNA-Seq2)(CAT#: AdV-SI0995WQ)

This product is a WDR46-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The WDR46 gene is required for localization of DDX21 and NCL to the granular compartment of the nucleolus. The expression of WDR46-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert WDR46-shRNA-Seq2
Related Target/Protein WDR46
Region CDS
TargetSeq CTGGAGAGTAATCCATACAGA
NCBI RefSeq NM_005452
Alternative Names UTP7; BING4; FP221; C6orf11
Titer >1*10^10 GC/mL
Related Diseases Respiratory Disease
Target Gene
Gene ID 9277
Uniprot ID O15213

Related Products