shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(Zc3hav1l-shRNA-Seq1)(CAT#: AdV-SI2717WQ)

This product is a Zc3hav1l-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Zc3hav1l-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Zc3hav1l-shRNA-Seq1
Related Target/Protein Zc3hav1l
Region CDS
TargetSeq GCGTCGTGAATTTCCAGATAA
NCBI RefSeq NM_172467
Alternative Names C7orf39
Titer >1*10^10 GC/mL
Target Gene
Gene ID 92092
Uniprot ID Q96H79

Related Products