shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Agpat4-shRNA-Seq5)(CAT#: AdV-SI1771WQ)

This product is a Agpat4-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Agpat4 gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family and this integral membrane protein converts lysophosphatidic acid to phosphatidic acid. The expression of Agpat4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Agpat4-shRNA-Seq5
Related Target/Protein Agpat4
Region CDS
TargetSeq CCTCAATCACAAGTTTGAGAT
NCBI RefSeq NM_026644
Alternative Names 1-AGPAT4; dJ473J16.2; LPAAT-delta
Titer >1*10^10 GC/mL
Related Diseases Cancer
Target Gene
Gene ID 56895
Uniprot ID Q9NRZ5

Related Products