shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(CCDC116-shRNA-Seq3)(CAT#: AdV-SI0108WQ)
This product is a CCDC116-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. A cis-eQTL genetic variant of the cancer-testis gene CCDC116 is associated with risk of multiple cancers. The expression of CCDC116-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | CCDC116-shRNA-Seq3 |
Related Target/Protein | CCDC116 |
Region | CDS |
TargetSeq | GATGAGGACAAGGATGAGGAT |
NCBI RefSeq | NM_152612 |
Titer | >1*10^10 GC/mL |
Related Diseases | colorectal cancer, breast cancer, esophageal cancer, gastric cancer |