shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Cdc42ep2-shRNA-Seq1)(CAT#: AdV-SI2211WQ)

This product is a Cdc42ep2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Cdc42ep2 gene is a member of the Borg family of CDC42 effector proteins. Coexpression of this protein with CDC42 suggested a role of this protein in actin filament assembly and cell shape control. The expression of Cdc42ep2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Cdc42ep2-shRNA-Seq1
Related Target/Protein Cdc42ep2
Region CDS
TargetSeq CTTTGACCTTCCCTTCCAGTT
NCBI RefSeq NM_026772
Alternative Names CEP2; BORG1
Titer >1*10^10 GC/mL
Target Gene
Gene ID 10435
Uniprot ID O14613

Related Products