shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Cdc42ep2-shRNA-Seq1)(CAT#: AdV-SI2211WQ)
This product is a Cdc42ep2-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Cdc42ep2 gene is a member of the Borg family of CDC42 effector proteins. Coexpression of this protein with CDC42 suggested a role of this protein in actin filament assembly and cell shape control. The expression of Cdc42ep2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Cdc42ep2-shRNA-Seq1 |
| Related Target/Protein | Cdc42ep2 |
| Region | CDS |
| TargetSeq | CTTTGACCTTCCCTTCCAGTT |
| NCBI RefSeq | NM_026772 |
| Alternative Names | CEP2; BORG1 |
| Titer | >1*10^10 GC/mL |